BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= GTGCTTGGCTGAGTTCACAA (evalue = 10) Length=20 Score E Sequences producing significant alignments: (Bits) Value gi|115529279|ref|NR_002944.2| Homo sapiens heterogeneous nuclea... 40.1 0.002 gi|58761497|ref|NM_001011725.1| Homo sapiens heterogeneous nucl... 40.1 0.002 gi|58761495|ref|NM_001011724.1| Homo sapiens heterogeneous nucl... 40.1 0.002 gi|1034579321|ref|XM_017019251.1| PREDICTED: Homo sapiens heter... 40.1 0.002 gi|994318938|ref|NM_002136.3| Homo sapiens heterogeneous nuclea... 40.1 0.002 gi|994318937|ref|NM_031157.3| Homo sapiens heterogeneous nuclea... 40.1 0.002 gi|1034674303|ref|XM_011530954.2| PREDICTED: Homo sapiens XK re... 36.2 0.030 gi|1034699225|ref|XR_001736706.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034699223|ref|XR_001736704.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034699224|ref|XR_001736705.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034686048|ref|XR_001734096.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034675920|ref|XR_001755852.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034675918|ref|XR_001755850.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034675919|ref|XR_001755851.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034597306|ref|XR_001752267.1| PREDICTED: Homo sapiens uncha... 30.2 1.9 gi|1034698285|ref|XR_001759394.1| PREDICTED: Homo sapiens uncha... 28.2 7.3 gi|1034688010|ref|XR_921863.2| PREDICTED: Homo sapiens uncharac... 28.2 7.3 gi|1034672565|ref|XR_001746662.1| PREDICTED: Homo sapiens uncha... 28.2 7.3 gi|817473756|ref|NM_001308394.1| Homo sapiens C-type lectin dom... 28.2 7.3 gi|1016841199|ref|NM_001322427.1| Homo sapiens calcium responsi... 28.2 7.3 gi|1034618635|ref|XR_922805.2| PREDICTED: Homo sapiens uncharac... 28.2 7.3 gi|166064055|ref|NM_001113536.1| Homo sapiens folate receptor b... 28.2 7.3 gi|166064051|ref|NM_001113534.1| Homo sapiens folate receptor b... 28.2 7.3 gi|166064053|ref|NM_001113535.1| Homo sapiens folate receptor b... 28.2 7.3 gi|166064049|ref|NM_000803.4| Homo sapiens folate receptor beta... 28.2 7.3 gi|170014702|ref|NM_003023.4| Homo sapiens SH3 domain binding p... 28.2 7.3 gi|224994220|ref|NM_001145856.1| Homo sapiens SH3 domain bindin... 28.2 7.3 gi|224994218|ref|NM_001145855.1| Homo sapiens SH3 domain bindin... 28.2 7.3 gi|170014704|ref|NM_001122681.1| Homo sapiens SH3 domain bindin... 28.2 7.3 > gi|115529279|ref|NR_002944.2| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 pseudogene 10 (HNRNPA1P10), non-coding RNA Length=1354 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCACAA 20 |||||||||||||||||||| Sbjct 1110 GTGCTTGGCTGAGTTCACAA 1091 > gi|58761497|ref|NM_001011725.1| Homo sapiens heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 2, mRNA Length=2224 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCACAA 20 |||||||||||||||||||| Sbjct 1984 GTGCTTGGCTGAGTTCACAA 1965 > gi|58761495|ref|NM_001011724.1| Homo sapiens heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1, mRNA Length=2365 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCACAA 20 |||||||||||||||||||| Sbjct 2125 GTGCTTGGCTGAGTTCACAA 2106 > gi|1034579321|ref|XM_017019251.1| PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant X3, mRNA Length=1702 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCACAA 20 |||||||||||||||||||| Sbjct 1089 GTGCTTGGCTGAGTTCACAA 1070 > gi|994318938|ref|NM_002136.3| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 1, mRNA Length=1799 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCACAA 20 |||||||||||||||||||| Sbjct 1170 GTGCTTGGCTGAGTTCACAA 1151 > gi|994318937|ref|NM_031157.3| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2, mRNA Length=1955 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCACAA 20 |||||||||||||||||||| Sbjct 1326 GTGCTTGGCTGAGTTCACAA 1307 > gi|1034674303|ref|XM_011530954.2| PREDICTED: Homo sapiens XK related, X-linked (XKRX), transcript variant X1, mRNA Length=4149 Score = 36.2 bits (18), Expect = 0.030 Identities = 18/18 (100%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGTTCAC 18 |||||||||||||||||| Sbjct 3527 GTGCTTGGCTGAGTTCAC 3510 > gi|1034699225|ref|XR_001736706.1| PREDICTED: Homo sapiens uncharacterized LOC105373204 (LOC105373204), transcript variant X3, ncRNA Length=13247 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GCTTGGCTGAGTTCA 17 ||||||||||||||| Sbjct 3630 GCTTGGCTGAGTTCA 3644 > gi|1034699223|ref|XR_001736704.1| PREDICTED: Homo sapiens uncharacterized LOC105373204 (LOC105373204), transcript variant X1, ncRNA Length=13678 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GCTTGGCTGAGTTCA 17 ||||||||||||||| Sbjct 4061 GCTTGGCTGAGTTCA 4075 > gi|1034699224|ref|XR_001736705.1| PREDICTED: Homo sapiens uncharacterized LOC105373204 (LOC105373204), transcript variant X2, ncRNA Length=13349 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GCTTGGCTGAGTTCA 17 ||||||||||||||| Sbjct 3732 GCTTGGCTGAGTTCA 3746 > gi|1034686048|ref|XR_001734096.1| PREDICTED: Homo sapiens uncharacterized LOC107984897 (LOC107984897), ncRNA Length=867 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 5 TTGGCTGAGTTCACA 19 ||||||||||||||| Sbjct 278 TTGGCTGAGTTCACA 292 > gi|1034675920|ref|XR_001755852.1| PREDICTED: Homo sapiens uncharacterized LOC105373204 (LOC105373204), transcript variant X3, ncRNA Length=13247 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GCTTGGCTGAGTTCA 17 ||||||||||||||| Sbjct 3630 GCTTGGCTGAGTTCA 3644 > gi|1034675918|ref|XR_001755850.1| PREDICTED: Homo sapiens uncharacterized LOC105373204 (LOC105373204), transcript variant X1, ncRNA Length=13678 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GCTTGGCTGAGTTCA 17 ||||||||||||||| Sbjct 4061 GCTTGGCTGAGTTCA 4075 > gi|1034675919|ref|XR_001755851.1| PREDICTED: Homo sapiens uncharacterized LOC105373204 (LOC105373204), transcript variant X2, ncRNA Length=13349 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GCTTGGCTGAGTTCA 17 ||||||||||||||| Sbjct 3732 GCTTGGCTGAGTTCA 3746 > gi|1034597306|ref|XR_001752267.1| PREDICTED: Homo sapiens uncharacterized LOC107984897 (LOC107984897), ncRNA Length=870 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 5 TTGGCTGAGTTCACA 19 ||||||||||||||| Sbjct 278 TTGGCTGAGTTCACA 292 > gi|1034698285|ref|XR_001759394.1| PREDICTED: Homo sapiens uncharacterized LOC105376030 (LOC105376030), transcript variant X2, ncRNA Length=2973 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGCTTGGCTGAGTT 15 |||||||||||||| Sbjct 1274 TGCTTGGCTGAGTT 1261 > gi|1034688010|ref|XR_921863.2| PREDICTED: Homo sapiens uncharacterized LOC105373431 (LOC105373431), ncRNA Length=1049 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 4 CTTGGCTGAGTTCA 17 |||||||||||||| Sbjct 428 CTTGGCTGAGTTCA 415 > gi|1034672565|ref|XR_001746662.1| PREDICTED: Homo sapiens uncharacterized LOC105376030 (LOC105376030), transcript variant X2, ncRNA Length=2973 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGCTTGGCTGAGTT 15 |||||||||||||| Sbjct 1274 TGCTTGGCTGAGTT 1261 > gi|817473756|ref|NM_001308394.1| Homo sapiens C-type lectin domain family 3 member B (CLEC3B), transcript variant 2, mRNA Length=772 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 GTGCTTGGCTGAGT 14 |||||||||||||| Sbjct 104 GTGCTTGGCTGAGT 91 > gi|1016841199|ref|NM_001322427.1| Homo sapiens calcium responsive transcription factor (CARF), transcript variant 6, mRNA Length=6786 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGCTTGGCTGAGTT 15 |||||||||||||| Sbjct 6122 TGCTTGGCTGAGTT 6109 > gi|1034618635|ref|XR_922805.2| PREDICTED: Homo sapiens uncharacterized LOC105373431 (LOC105373431), ncRNA Length=1049 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 4 CTTGGCTGAGTTCA 17 |||||||||||||| Sbjct 428 CTTGGCTGAGTTCA 415 > gi|166064055|ref|NM_001113536.1| Homo sapiens folate receptor beta (FOLR2), transcript variant 4, mRNA Length=1127 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 CTTGGCTGAGTTCA 17 |||||||||||||| Sbjct 917 CTTGGCTGAGTTCA 930 > gi|166064051|ref|NM_001113534.1| Homo sapiens folate receptor beta (FOLR2), transcript variant 2, mRNA Length=1139 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 CTTGGCTGAGTTCA 17 |||||||||||||| Sbjct 929 CTTGGCTGAGTTCA 942 > gi|166064053|ref|NM_001113535.1| Homo sapiens folate receptor beta (FOLR2), transcript variant 3, mRNA Length=1133 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 CTTGGCTGAGTTCA 17 |||||||||||||| Sbjct 923 CTTGGCTGAGTTCA 936 > gi|166064049|ref|NM_000803.4| Homo sapiens folate receptor beta (FOLR2), transcript variant 1, mRNA Length=1145 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 CTTGGCTGAGTTCA 17 |||||||||||||| Sbjct 935 CTTGGCTGAGTTCA 948 > gi|170014702|ref|NM_003023.4| Homo sapiens SH3 domain binding protein 2 (SH3BP2), transcript variant 1, mRNA Length=9209 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TGGCTGAGTTCACA 19 |||||||||||||| Sbjct 2889 TGGCTGAGTTCACA 2902 > gi|224994220|ref|NM_001145856.1| Homo sapiens SH3 domain binding protein 2 (SH3BP2), transcript variant 3, mRNA Length=9158 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TGGCTGAGTTCACA 19 |||||||||||||| Sbjct 2838 TGGCTGAGTTCACA 2851 > gi|224994218|ref|NM_001145855.1| Homo sapiens SH3 domain binding protein 2 (SH3BP2), transcript variant 4, mRNA Length=9211 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TGGCTGAGTTCACA 19 |||||||||||||| Sbjct 2891 TGGCTGAGTTCACA 2904 > gi|170014704|ref|NM_001122681.1| Homo sapiens SH3 domain binding protein 2 (SH3BP2), transcript variant 2, mRNA Length=9068 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TGGCTGAGTTCACA 19 |||||||||||||| Sbjct 2748 TGGCTGAGTTCACA 2761 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 2337180340 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2