BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= GGGATCTCTATGTCGGCATGTAG (evalue = 10) Length=23 Score E Sequences producing significant alignments: (Bits) Value gi|1034583593|ref|XM_005266216.4| PREDICTED: Homo sapiens cycli... 46.1 5e-05 gi|767977138|ref|XM_011534864.1| PREDICTED: Homo sapiens cyclin... 46.1 5e-05 gi|971460834|ref|NM_001318368.1| Homo sapiens cyclin-dependent ... 46.1 5e-05 gi|971460838|ref|NM_001260.2| Homo sapiens cyclin-dependent kin... 46.1 5e-05 > gi|1034583593|ref|XM_005266216.4| PREDICTED: Homo sapiens cyclin-dependent kinase 8 (CDK8), transcript variant X1, mRNA Length=2448 Score = 46.1 bits (23), Expect = 5e-05 Identities = 23/23 (100%), Gaps = 0/23 (0%) Strand=Plus/Plus Query 1 GGGATCTCTATGTCGGCATGTAG 23 ||||||||||||||||||||||| Sbjct 68 GGGATCTCTATGTCGGCATGTAG 90 > gi|767977138|ref|XM_011534864.1| PREDICTED: Homo sapiens cyclin-dependent kinase 8 (CDK8), transcript variant X3, mRNA Length=3011 Score = 46.1 bits (23), Expect = 5e-05 Identities = 23/23 (100%), Gaps = 0/23 (0%) Strand=Plus/Plus Query 1 GGGATCTCTATGTCGGCATGTAG 23 ||||||||||||||||||||||| Sbjct 689 GGGATCTCTATGTCGGCATGTAG 711 > gi|971460834|ref|NM_001318368.1| Homo sapiens cyclin-dependent kinase 8 (CDK8), transcript variant 2, mRNA Length=3098 Score = 46.1 bits (23), Expect = 5e-05 Identities = 23/23 (100%), Gaps = 0/23 (0%) Strand=Plus/Plus Query 1 GGGATCTCTATGTCGGCATGTAG 23 ||||||||||||||||||||||| Sbjct 710 GGGATCTCTATGTCGGCATGTAG 732 > gi|971460838|ref|NM_001260.2| Homo sapiens cyclin-dependent kinase 8 (CDK8), transcript variant 1, mRNA Length=3101 Score = 46.1 bits (23), Expect = 5e-05 Identities = 23/23 (100%), Gaps = 0/23 (0%) Strand=Plus/Plus Query 1 GGGATCTCTATGTCGGCATGTAG 23 ||||||||||||||||||||||| Sbjct 710 GGGATCTCTATGTCGGCATGTAG 732 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 4090065595 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2