BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= GGCAGTGGGATGATATAAAGTCTCGAGACTTTATATCATCCCACTGCC (evalue = 10) Length=48 Score E Sequences producing significant alignments: (Bits) Value gi|222537766|ref|NR_026730.1| Homo sapiens transmembrane phosph... 42.1 0.004 gi|299523022|ref|NR_033805.1| Homo sapiens WAC antisense RNA 1 ... 34.2 0.92 gi|1034640509|ref|XM_017008395.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640511|ref|XM_017008396.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640495|ref|XM_017008388.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|919185130|ref|NM_001080477.3| Homo sapiens teneurin transmem... 32.2 3.6 gi|1034640493|ref|XM_017008387.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640491|ref|XM_017008386.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640507|ref|XM_017008394.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640505|ref|XM_017008393.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640503|ref|XM_017008392.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640501|ref|XM_017008391.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640499|ref|XM_017008390.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640497|ref|XM_017008389.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 gi|1034640489|ref|XM_017008385.1| PREDICTED: Homo sapiens teneu... 32.2 3.6 > gi|222537766|ref|NR_026730.1| Homo sapiens transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1 (TPTE2P1), non-coding RNA Length=6477 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GGCAGTGGGATGATATAAAGT 21 ||||||||||||||||||||| Sbjct 5776 GGCAGTGGGATGATATAAAGT 5796 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 ACTTTATATCATCCCACTGCC 48 ||||||||||||||||||||| Sbjct 5796 ACTTTATATCATCCCACTGCC 5776 > gi|299523022|ref|NR_033805.1| Homo sapiens WAC antisense RNA 1 (head to head) (WAC-AS1), long non-coding RNA Length=5376 Score = 34.2 bits (17), Expect = 0.92 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 1 GGCAGTGGGATGATATA 17 ||||||||||||||||| Sbjct 4760 GGCAGTGGGATGATATA 4776 Score = 34.2 bits (17), Expect = 0.92 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGCC 48 ||||||||||||||||| Sbjct 4776 TATATCATCCCACTGCC 4760 > gi|1034640509|ref|XM_017008395.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X11, mRNA Length=10349 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 6906 GCAGTGGGATGATATA 6921 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 6921 TATATCATCCCACTGC 6906 > gi|1034640511|ref|XM_017008396.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X12, mRNA Length=10384 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 6941 GCAGTGGGATGATATA 6956 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 6956 TATATCATCCCACTGC 6941 > gi|1034640495|ref|XM_017008388.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X4, mRNA Length=10911 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7468 GCAGTGGGATGATATA 7483 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7483 TATATCATCCCACTGC 7468 > gi|919185130|ref|NM_001080477.3| Homo sapiens teneurin transmembrane protein 3 (TENM3), mRNA Length=10894 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7447 GCAGTGGGATGATATA 7462 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7462 TATATCATCCCACTGC 7447 > gi|1034640493|ref|XM_017008387.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X3, mRNA Length=10936 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7493 GCAGTGGGATGATATA 7508 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7508 TATATCATCCCACTGC 7493 > gi|1034640491|ref|XM_017008386.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X2, mRNA Length=9073 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7520 GCAGTGGGATGATATA 7535 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7535 TATATCATCCCACTGC 7520 > gi|1034640507|ref|XM_017008394.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X10, mRNA Length=11097 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7654 GCAGTGGGATGATATA 7669 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7669 TATATCATCCCACTGC 7654 > gi|1034640505|ref|XM_017008393.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X9, mRNA Length=11328 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7885 GCAGTGGGATGATATA 7900 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7900 TATATCATCCCACTGC 7885 > gi|1034640503|ref|XM_017008392.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X8, mRNA Length=11349 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7906 GCAGTGGGATGATATA 7921 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7921 TATATCATCCCACTGC 7906 > gi|1034640501|ref|XM_017008391.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X7, mRNA Length=11352 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7909 GCAGTGGGATGATATA 7924 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7924 TATATCATCCCACTGC 7909 > gi|1034640499|ref|XM_017008390.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X6, mRNA Length=11355 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7912 GCAGTGGGATGATATA 7927 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7927 TATATCATCCCACTGC 7912 > gi|1034640497|ref|XM_017008389.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X5, mRNA Length=11373 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7930 GCAGTGGGATGATATA 7945 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7945 TATATCATCCCACTGC 7930 > gi|1034640489|ref|XM_017008385.1| PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X1, mRNA Length=11376 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GCAGTGGGATGATATA 17 |||||||||||||||| Sbjct 7933 GCAGTGGGATGATATA 7948 Score = 32.2 bits (16), Expect = 3.6 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 32 TATATCATCCCACTGC 47 |||||||||||||||| Sbjct 7948 TATATCATCCCACTGC 7933 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 18107678429 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2