BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= GCCAATATTCACTACGTATTACTCGAGTAATACGTAGTGAATATTGGCTTTTT (evalue = 10) Length=53 Score E Sequences producing significant alignments: (Bits) Value gi|1034656054|ref|XM_017012356.1| PREDICTED: Homo sapiens anill... 42.1 0.004 gi|1034656053|ref|XM_006715747.3| PREDICTED: Homo sapiens anill... 42.1 0.004 gi|1034656051|ref|XM_017012355.1| PREDICTED: Homo sapiens anill... 42.1 0.004 gi|1034656049|ref|XM_017012354.1| PREDICTED: Homo sapiens anill... 42.1 0.004 gi|578813548|ref|XM_006715746.1| PREDICTED: Homo sapiens anilli... 42.1 0.004 gi|697272151|ref|NM_001284302.2| Homo sapiens anillin actin bin... 42.1 0.004 gi|697272139|ref|NM_001284301.2| Homo sapiens anillin actin bin... 42.1 0.004 gi|697272137|ref|NM_018685.4| Homo sapiens anillin actin bindin... 42.1 0.004 > gi|1034656054|ref|XM_017012356.1| PREDICTED: Homo sapiens anillin actin binding protein (ANLN), transcript variant X5, mRNA Length=4664 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3605 TAATACGTAGTGAATATTGGC 3585 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3585 GCCAATATTCACTACGTATTA 3605 > gi|1034656053|ref|XM_006715747.3| PREDICTED: Homo sapiens anillin actin binding protein (ANLN), transcript variant X4, mRNA Length=4730 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3671 TAATACGTAGTGAATATTGGC 3651 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3651 GCCAATATTCACTACGTATTA 3671 > gi|1034656051|ref|XM_017012355.1| PREDICTED: Homo sapiens anillin actin binding protein (ANLN), transcript variant X3, mRNA Length=4775 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3716 TAATACGTAGTGAATATTGGC 3696 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3696 GCCAATATTCACTACGTATTA 3716 > gi|1034656049|ref|XM_017012354.1| PREDICTED: Homo sapiens anillin actin binding protein (ANLN), transcript variant X2, mRNA Length=4829 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3770 TAATACGTAGTGAATATTGGC 3750 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3750 GCCAATATTCACTACGTATTA 3770 > gi|578813548|ref|XM_006715746.1| PREDICTED: Homo sapiens anillin actin binding protein (ANLN), transcript variant X1, mRNA Length=4841 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3782 TAATACGTAGTGAATATTGGC 3762 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3762 GCCAATATTCACTACGTATTA 3782 > gi|697272151|ref|NM_001284302.2| Homo sapiens anillin actin binding protein (ANLN), transcript variant 3, mRNA Length=4690 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3617 TAATACGTAGTGAATATTGGC 3597 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3597 GCCAATATTCACTACGTATTA 3617 > gi|697272139|ref|NM_001284301.2| Homo sapiens anillin actin binding protein (ANLN), transcript variant 2, mRNA Length=4693 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3620 TAATACGTAGTGAATATTGGC 3600 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3600 GCCAATATTCACTACGTATTA 3620 > gi|697272137|ref|NM_018685.4| Homo sapiens anillin actin binding protein (ANLN), transcript variant 1, mRNA Length=4804 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 28 TAATACGTAGTGAATATTGGC 48 ||||||||||||||||||||| Sbjct 3731 TAATACGTAGTGAATATTGGC 3711 Score = 42.1 bits (21), Expect = 0.004 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 1 GCCAATATTCACTACGTATTA 21 ||||||||||||||||||||| Sbjct 3711 GCCAATATTCACTACGTATTA 3731 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 21028271724 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2