BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= CTGAGTCCAAATAGCCCAAGG (evalue = 10) Length=21 Score E Sequences producing significant alignments: (Bits) Value gi|589811556|ref|NM_001290230.1| Homo sapiens cyclin-dependent ... 42.1 6e-04 gi|589811555|ref|NM_052827.3| Homo sapiens cyclin-dependent kin... 42.1 6e-04 gi|589811554|ref|NM_001798.4| Homo sapiens cyclin-dependent kin... 42.1 6e-04 gi|767972771|ref|XM_011537732.1| PREDICTED: Homo sapiens cyclin... 42.1 6e-04 gi|1034640480|ref|XM_017008382.1| PREDICTED: Homo sapiens BMP2 ... 30.2 2.3 gi|1034640478|ref|XM_017008381.1| PREDICTED: Homo sapiens BMP2 ... 30.2 2.3 gi|767932289|ref|XM_011532102.1| PREDICTED: Homo sapiens BMP2 i... 30.2 2.3 gi|530377940|ref|XM_005263117.1| PREDICTED: Homo sapiens BMP2 i... 30.2 2.3 gi|38787903|ref|NM_017593.3| Homo sapiens BMP2 inducible kinase... 30.2 2.3 gi|38787934|ref|NM_198892.1| Homo sapiens BMP2 inducible kinase... 30.2 2.3 gi|77993294|ref|NR_002588.1| Homo sapiens small nucleolar RNA, ... 30.2 2.3 gi|223890220|ref|NM_025040.3| Homo sapiens zinc finger protein ... 30.2 2.3 gi|1034685305|ref|XM_016999606.1| PREDICTED: Homo sapiens leuko... 28.2 9.2 gi|1034685303|ref|XM_016999605.1| PREDICTED: Homo sapiens leuko... 28.2 9.2 gi|1034685302|ref|XR_001733748.1| PREDICTED: Homo sapiens leuko... 28.2 9.2 gi|1034685300|ref|XM_016999604.1| PREDICTED: Homo sapiens leuko... 28.2 9.2 gi|1034685298|ref|XR_001733746.1| PREDICTED: Homo sapiens leuko... 28.2 9.2 gi|1034685299|ref|XR_001733747.1| PREDICTED: Homo sapiens leuko... 28.2 9.2 gi|1034681520|ref|XR_913270.2| PREDICTED: Homo sapiens uncharac... 28.2 9.2 gi|387849243|ref|NM_003123.4| Homo sapiens sialophorin (SPN), t... 28.2 9.2 gi|387849240|ref|NM_001030288.2| Homo sapiens sialophorin (SPN)... 28.2 9.2 gi|530404006|ref|XM_005267771.1| PREDICTED: Homo sapiens transm... 28.2 9.2 gi|578825905|ref|XM_006720178.1| PREDICTED: Homo sapiens transm... 28.2 9.2 gi|578825901|ref|XM_006720176.1| PREDICTED: Homo sapiens transm... 28.2 9.2 gi|767980768|ref|XM_011536852.1| PREDICTED: Homo sapiens transm... 28.2 9.2 gi|767980770|ref|XM_011536853.1| PREDICTED: Homo sapiens transm... 28.2 9.2 gi|93277079|ref|NM_017799.3| Homo sapiens transmembrane protein... 28.2 9.2 gi|530404005|ref|XR_245695.1| PREDICTED: Homo sapiens transmemb... 28.2 9.2 gi|1034587338|ref|XR_001750387.1| PREDICTED: Homo sapiens trans... 28.2 9.2 gi|1034587334|ref|XR_001750382.1| PREDICTED: Homo sapiens trans... 28.2 9.2 gi|1034587336|ref|XR_001750385.1| PREDICTED: Homo sapiens trans... 28.2 9.2 gi|1034587337|ref|XR_001750386.1| PREDICTED: Homo sapiens trans... 28.2 9.2 gi|1034577013|ref|XR_950274.2| PREDICTED: Homo sapiens uncharac... 28.2 9.2 gi|1034670716|ref|XR_001746354.1| PREDICTED: Homo sapiens REX4 ... 28.2 9.2 gi|525345308|ref|NM_020385.3| Homo sapiens REX4 homolog, 3'-5' ... 28.2 9.2 gi|525345333|ref|NM_001279350.1| Homo sapiens REX4 homolog, 3'-... 28.2 9.2 gi|525345318|ref|NM_001279349.1| Homo sapiens REX4 homolog, 3'-... 28.2 9.2 gi|525345445|ref|NR_103996.1| Homo sapiens REX4 homolog, 3'-5' ... 28.2 9.2 gi|525345444|ref|NR_103995.1| Homo sapiens REX4 homolog, 3'-5' ... 28.2 9.2 gi|525345343|ref|NM_001279351.1| Homo sapiens REX4 homolog, 3'-... 28.2 9.2 gi|1034687096|ref|XR_919010.2| PREDICTED: Homo sapiens uncharac... 28.2 9.2 gi|1034697888|ref|XR_001759204.1| PREDICTED: Homo sapiens uncha... 28.2 9.2 gi|1034677235|ref|XR_001756491.1| PREDICTED: Homo sapiens uncha... 28.2 9.2 gi|1034605355|ref|XR_001753448.1| PREDICTED: Homo sapiens uncha... 28.2 9.2 gi|1034604535|ref|XM_011525728.2| PREDICTED: Homo sapiens A kin... 28.2 9.2 gi|1034598106|ref|XM_011523638.2| PREDICTED: Homo sapiens cytoc... 28.2 9.2 gi|974987432|ref|NM_002423.4| Homo sapiens matrix metallopeptid... 28.2 9.2 gi|641451080|ref|NR_120529.1| Homo sapiens uncharacterized LOC1... 28.2 9.2 gi|1034663343|ref|XR_001746115.1| PREDICTED: Homo sapiens uncha... 28.2 9.2 > gi|589811556|ref|NM_001290230.1| Homo sapiens cyclin-dependent kinase 2 (CDK2), transcript variant 3, mRNA Length=2121 Score = 42.1 bits (21), Expect = 6e-04 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAGCCCAAGG 21 ||||||||||||||||||||| Sbjct 1044 CTGAGTCCAAATAGCCCAAGG 1024 > gi|589811555|ref|NM_052827.3| Homo sapiens cyclin-dependent kinase 2 (CDK2), transcript variant 2, mRNA Length=2199 Score = 42.1 bits (21), Expect = 6e-04 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAGCCCAAGG 21 ||||||||||||||||||||| Sbjct 1122 CTGAGTCCAAATAGCCCAAGG 1102 > gi|589811554|ref|NM_001798.4| Homo sapiens cyclin-dependent kinase 2 (CDK2), transcript variant 1, mRNA Length=2301 Score = 42.1 bits (21), Expect = 6e-04 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAGCCCAAGG 21 ||||||||||||||||||||| Sbjct 1224 CTGAGTCCAAATAGCCCAAGG 1204 > gi|767972771|ref|XM_011537732.1| PREDICTED: Homo sapiens cyclin-dependent kinase 2 (CDK2), transcript variant X1, mRNA Length=2445 Score = 42.1 bits (21), Expect = 6e-04 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAGCCCAAGG 21 ||||||||||||||||||||| Sbjct 1368 CTGAGTCCAAATAGCCCAAGG 1348 > gi|1034640480|ref|XM_017008382.1| PREDICTED: Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant X3, mRNA Length=7439 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 AGTCCAAATAGCCCA 18 ||||||||||||||| Sbjct 43 AGTCCAAATAGCCCA 29 > gi|1034640478|ref|XM_017008381.1| PREDICTED: Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant X2, mRNA Length=7736 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 AGTCCAAATAGCCCA 18 ||||||||||||||| Sbjct 258 AGTCCAAATAGCCCA 244 > gi|767932289|ref|XM_011532102.1| PREDICTED: Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant X4, mRNA Length=2442 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 AGTCCAAATAGCCCA 18 ||||||||||||||| Sbjct 481 AGTCCAAATAGCCCA 467 > gi|530377940|ref|XM_005263117.1| PREDICTED: Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant X1, mRNA Length=7848 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 AGTCCAAATAGCCCA 18 ||||||||||||||| Sbjct 481 AGTCCAAATAGCCCA 467 > gi|38787903|ref|NM_017593.3| Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant 2, mRNA Length=2681 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 AGTCCAAATAGCCCA 18 ||||||||||||||| Sbjct 506 AGTCCAAATAGCCCA 492 > gi|38787934|ref|NM_198892.1| Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant 1, mRNA Length=3859 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 AGTCCAAATAGCCCA 18 ||||||||||||||| Sbjct 506 AGTCCAAATAGCCCA 492 > gi|77993294|ref|NR_002588.1| Homo sapiens small nucleolar RNA, H/ACA box 4 (SNORA4), small nucleolar RNA Length=137 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 6 TCCAAATAGCCCAAG 20 ||||||||||||||| Sbjct 65 TCCAAATAGCCCAAG 51 > gi|223890220|ref|NM_025040.3| Homo sapiens zinc finger protein 614 (ZNF614), mRNA Length=4676 Score = 30.2 bits (15), Expect = 2.3 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 6 TCCAAATAGCCCAAG 20 ||||||||||||||| Sbjct 3323 TCCAAATAGCCCAAG 3337 > gi|1034685305|ref|XM_016999606.1| PREDICTED: Homo sapiens leukosialin (LOC105369247), transcript variant X6, mRNA Length=9412 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3568 TGAGTCCAAATAGC 3555 > gi|1034685303|ref|XM_016999605.1| PREDICTED: Homo sapiens leukosialin (LOC105369247), transcript variant X5, mRNA Length=9415 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3568 TGAGTCCAAATAGC 3555 > gi|1034685302|ref|XR_001733748.1| PREDICTED: Homo sapiens leukosialin (LOC105369247), transcript variant X4, misc_RNA Length=9475 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3631 TGAGTCCAAATAGC 3618 > gi|1034685300|ref|XM_016999604.1| PREDICTED: Homo sapiens leukosialin (LOC105369247), transcript variant X3, mRNA Length=7470 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3805 TGAGTCCAAATAGC 3792 > gi|1034685298|ref|XR_001733746.1| PREDICTED: Homo sapiens leukosialin (LOC105369247), transcript variant X1, misc_RNA Length=9649 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3805 TGAGTCCAAATAGC 3792 > gi|1034685299|ref|XR_001733747.1| PREDICTED: Homo sapiens leukosialin (LOC105369247), transcript variant X2, misc_RNA Length=9652 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3805 TGAGTCCAAATAGC 3792 > gi|1034681520|ref|XR_913270.2| PREDICTED: Homo sapiens uncharacterized LOC105369371 (LOC105369371), ncRNA Length=3465 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1662 CAAATAGCCCAAGG 1649 > gi|387849243|ref|NM_003123.4| Homo sapiens sialophorin (SPN), transcript variant 2, mRNA Length=6911 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3598 TGAGTCCAAATAGC 3585 > gi|387849240|ref|NM_001030288.2| Homo sapiens sialophorin (SPN), transcript variant 1, mRNA Length=6944 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 TGAGTCCAAATAGC 15 |||||||||||||| Sbjct 3631 TGAGTCCAAATAGC 3618 > gi|530404006|ref|XM_005267771.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X12, mRNA Length=3835 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2521 CTGAGTCCAAATAG 2508 > gi|578825905|ref|XM_006720178.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X13, mRNA Length=3938 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2624 CTGAGTCCAAATAG 2611 > gi|578825901|ref|XM_006720176.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X7, mRNA Length=4053 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2739 CTGAGTCCAAATAG 2726 > gi|767980768|ref|XM_011536852.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X4, mRNA Length=4256 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2942 CTGAGTCCAAATAG 2929 > gi|767980770|ref|XM_011536853.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X5, mRNA Length=4434 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 3120 CTGAGTCCAAATAG 3107 > gi|93277079|ref|NM_017799.3| Homo sapiens transmembrane protein 260 (TMEM260), mRNA Length=4278 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2950 CTGAGTCCAAATAG 2937 > gi|530404005|ref|XR_245695.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X10, misc_RNA Length=4094 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2780 CTGAGTCCAAATAG 2767 > gi|1034587338|ref|XR_001750387.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X11, misc_RNA Length=4249 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 2935 CTGAGTCCAAATAG 2922 > gi|1034587334|ref|XR_001750382.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X3, misc_RNA Length=4421 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 3107 CTGAGTCCAAATAG 3094 > gi|1034587336|ref|XR_001750385.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X8, misc_RNA Length=4360 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 3046 CTGAGTCCAAATAG 3033 > gi|1034587337|ref|XR_001750386.1| PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X9, misc_RNA Length=4586 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CTGAGTCCAAATAG 14 |||||||||||||| Sbjct 3272 CTGAGTCCAAATAG 3259 > gi|1034577013|ref|XR_950274.2| PREDICTED: Homo sapiens uncharacterized LOC105369371 (LOC105369371), ncRNA Length=3465 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1662 CAAATAGCCCAAGG 1649 > gi|1034670716|ref|XR_001746354.1| PREDICTED: Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant X1, misc_RNA Length=2132 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1925 CAAATAGCCCAAGG 1912 > gi|525345308|ref|NM_020385.3| Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant 1, mRNA Length=2433 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 2205 CAAATAGCCCAAGG 2192 > gi|525345333|ref|NM_001279350.1| Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant 3, mRNA Length=2255 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 2027 CAAATAGCCCAAGG 2014 > gi|525345318|ref|NM_001279349.1| Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant 2, mRNA Length=1917 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1689 CAAATAGCCCAAGG 1676 > gi|525345445|ref|NR_103996.1| Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant 6, non-coding RNA Length=2086 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1858 CAAATAGCCCAAGG 1845 > gi|525345444|ref|NR_103995.1| Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant 5, non-coding RNA Length=1892 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1664 CAAATAGCCCAAGG 1651 > gi|525345343|ref|NM_001279351.1| Homo sapiens REX4 homolog, 3'-5' exonuclease (REXO4), transcript variant 4, mRNA Length=2116 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 1888 CAAATAGCCCAAGG 1875 > gi|1034687096|ref|XR_919010.2| PREDICTED: Homo sapiens uncharacterized LOC105372115 (LOC105372115), ncRNA Length=4895 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 7 CCAAATAGCCCAAG 20 |||||||||||||| Sbjct 3950 CCAAATAGCCCAAG 3963 > gi|1034697888|ref|XR_001759204.1| PREDICTED: Homo sapiens uncharacterized LOC107986981 (LOC107986981), ncRNA Length=5948 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 GTCCAAATAGCCCA 18 |||||||||||||| Sbjct 1651 GTCCAAATAGCCCA 1664 > gi|1034677235|ref|XR_001756491.1| PREDICTED: Homo sapiens uncharacterized LOC105372115 (LOC105372115), ncRNA Length=4893 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 7 CCAAATAGCCCAAG 20 |||||||||||||| Sbjct 3948 CCAAATAGCCCAAG 3961 > gi|1034605355|ref|XR_001753448.1| PREDICTED: Homo sapiens uncharacterized LOC105372115 (LOC105372115), ncRNA Length=4893 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 7 CCAAATAGCCCAAG 20 |||||||||||||| Sbjct 3948 CCAAATAGCCCAAG 3961 > gi|1034604535|ref|XM_011525728.2| PREDICTED: Homo sapiens A kinase (PRKA) anchor inhibitor 1 (AKAIN1), transcript variant X1, mRNA Length=4627 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 185 CAAATAGCCCAAGG 198 > gi|1034598106|ref|XM_011523638.2| PREDICTED: Homo sapiens cytochrome b5 domain containing 1 (CYB5D1), transcript variant X1, mRNA Length=1705 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TCCAAATAGCCCAA 19 |||||||||||||| Sbjct 1008 TCCAAATAGCCCAA 1021 > gi|974987432|ref|NM_002423.4| Homo sapiens matrix metallopeptidase 7 (MMP7), mRNA Length=1153 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TCCAAATAGCCCAA 19 |||||||||||||| Sbjct 347 TCCAAATAGCCCAA 360 > gi|641451080|ref|NR_120529.1| Homo sapiens uncharacterized LOC101928443 (LOC101928443), transcript variant 1, long non-coding RNA Length=1768 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 8 CAAATAGCCCAAGG 21 |||||||||||||| Sbjct 559 CAAATAGCCCAAGG 572 > gi|1034663343|ref|XR_001746115.1| PREDICTED: Homo sapiens uncharacterized LOC107986981 (LOC107986981), ncRNA Length=5948 Score = 28.2 bits (14), Expect = 9.2 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 GTCCAAATAGCCCA 18 |||||||||||||| Sbjct 1651 GTCCAAATAGCCCA 1664 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 2921475425 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2