BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= CCTTCCAGACAACTATGAGATCTCGAGATCTCATAGTTGTCTGGAAGGTTTTT (evalue = 10) Length=53 Score E Sequences producing significant alignments: (Bits) Value gi|1034611107|ref|XM_017003182.1| PREDICTED: Homo sapiens ubiqu... 44.1 0.001 gi|767913679|ref|XM_011532487.1| PREDICTED: Homo sapiens ubiqui... 44.1 0.001 gi|767913678|ref|XM_006711923.2| PREDICTED: Homo sapiens ubiqui... 44.1 0.001 gi|767913677|ref|XR_939653.1| PREDICTED: Homo sapiens ubiquitin... 44.1 0.001 gi|767913676|ref|XR_939652.1| PREDICTED: Homo sapiens ubiquitin... 44.1 0.001 gi|376319200|ref|NM_001256726.1| Homo sapiens ubiquitin specifi... 44.1 0.001 gi|376319198|ref|NM_001256725.1| Homo sapiens ubiquitin specifi... 44.1 0.001 gi|376000080|ref|NM_006590.3| Homo sapiens ubiquitin specific p... 44.1 0.001 gi|767913681|ref|XM_011532488.1| PREDICTED: Homo sapiens ubiqui... 44.1 0.001 gi|1034611106|ref|XR_001738593.1| PREDICTED: Homo sapiens ubiqu... 44.1 0.001 gi|376319205|ref|NM_001256728.1| Homo sapiens ubiquitin specifi... 44.1 0.001 gi|376319202|ref|NM_001256727.1| Homo sapiens ubiquitin specifi... 44.1 0.001 gi|578802667|ref|XM_006711922.1| PREDICTED: Homo sapiens ubiqui... 44.1 0.001 gi|376319204|ref|NR_046347.1| Homo sapiens ubiquitin specific p... 44.1 0.001 gi|1034694077|ref|XR_001757300.1| PREDICTED: Homo sapiens uncha... 32.2 4.2 gi|1034647828|ref|XR_001742907.1| PREDICTED: Homo sapiens uncha... 32.2 4.2 > gi|1034611107|ref|XM_017003182.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X6, mRNA Length=2234 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 604 GATCTCATAGTTGTCTGGAAGG 583 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 583 CCTTCCAGACAACTATGAGATC 604 > gi|767913679|ref|XM_011532487.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X7, mRNA Length=2230 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 600 GATCTCATAGTTGTCTGGAAGG 579 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 579 CCTTCCAGACAACTATGAGATC 600 > gi|767913678|ref|XM_006711923.2| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X4, mRNA Length=2224 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 594 GATCTCATAGTTGTCTGGAAGG 573 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 573 CCTTCCAGACAACTATGAGATC 594 > gi|767913677|ref|XR_939653.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X2, misc_RNA Length=2164 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 611 GATCTCATAGTTGTCTGGAAGG 590 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 590 CCTTCCAGACAACTATGAGATC 611 > gi|767913676|ref|XR_939652.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X1, misc_RNA Length=2327 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 611 GATCTCATAGTTGTCTGGAAGG 590 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 590 CCTTCCAGACAACTATGAGATC 611 > gi|376319200|ref|NM_001256726.1| Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 3, mRNA Length=2162 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 647 GATCTCATAGTTGTCTGGAAGG 626 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 626 CCTTCCAGACAACTATGAGATC 647 > gi|376319198|ref|NM_001256725.1| Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 2, mRNA Length=2135 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 647 GATCTCATAGTTGTCTGGAAGG 626 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 626 CCTTCCAGACAACTATGAGATC 647 > gi|376000080|ref|NM_006590.3| Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 1, mRNA Length=2298 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 647 GATCTCATAGTTGTCTGGAAGG 626 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 626 CCTTCCAGACAACTATGAGATC 647 > gi|767913681|ref|XM_011532488.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X8, mRNA Length=2163 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 533 GATCTCATAGTTGTCTGGAAGG 512 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 512 CCTTCCAGACAACTATGAGATC 533 > gi|1034611106|ref|XR_001738593.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X3, misc_RNA Length=2243 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 527 GATCTCATAGTTGTCTGGAAGG 506 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 506 CCTTCCAGACAACTATGAGATC 527 > gi|376319205|ref|NM_001256728.1| Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 5, mRNA Length=2108 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 457 GATCTCATAGTTGTCTGGAAGG 436 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 436 CCTTCCAGACAACTATGAGATC 457 > gi|376319202|ref|NM_001256727.1| Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 4, mRNA Length=2183 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 532 GATCTCATAGTTGTCTGGAAGG 511 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 511 CCTTCCAGACAACTATGAGATC 532 > gi|578802667|ref|XM_006711922.1| PREDICTED: Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant X5, mRNA Length=2145 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 515 GATCTCATAGTTGTCTGGAAGG 494 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 494 CCTTCCAGACAACTATGAGATC 515 > gi|376319204|ref|NR_046347.1| Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 6, non-coding RNA Length=2186 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 27 GATCTCATAGTTGTCTGGAAGG 48 |||||||||||||||||||||| Sbjct 535 GATCTCATAGTTGTCTGGAAGG 514 Score = 44.1 bits (22), Expect = 0.001 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 CCTTCCAGACAACTATGAGATC 22 |||||||||||||||||||||| Sbjct 514 CCTTCCAGACAACTATGAGATC 535 > gi|1034694077|ref|XR_001757300.1| PREDICTED: Homo sapiens uncharacterized LOC107986455 (LOC107986455), ncRNA Length=1701 Score = 32.2 bits (16), Expect = 4.2 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 35 AGTTGTCTGGAAGGTT 50 |||||||||||||||| Sbjct 345 AGTTGTCTGGAAGGTT 330 > gi|1034647828|ref|XR_001742907.1| PREDICTED: Homo sapiens uncharacterized LOC107986455 (LOC107986455), ncRNA Length=1701 Score = 32.2 bits (16), Expect = 4.2 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 35 AGTTGTCTGGAAGGTT 50 |||||||||||||||| Sbjct 345 AGTTGTCTGGAAGGTT 330 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 21028271724 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2