BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= AGTCCTTCCACGATACCAAAGT (evalue = 10) Length=22 Score E Sequences producing significant alignments: (Bits) Value gi|576583514|ref|NM_001256799.2| Homo sapiens glyceraldehyde-3-... 44.1 2e-04 gi|576583523|ref|NM_001289746.1| Homo sapiens glyceraldehyde-3-... 44.1 2e-04 gi|576583510|ref|NM_002046.5| Homo sapiens glyceraldehyde-3-pho... 44.1 2e-04 gi|576583518|ref|NM_001289745.1| Homo sapiens glyceraldehyde-3-... 44.1 2e-04 gi|950426250|ref|NM_000863.2| Homo sapiens 5-hydroxytryptamine ... 30.2 2.8 > gi|576583514|ref|NM_001256799.2| Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 2, mRNA Length=1455 Score = 44.1 bits (22), Expect = 2e-04 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 1 AGTCCTTCCACGATACCAAAGT 22 |||||||||||||||||||||| Sbjct 743 AGTCCTTCCACGATACCAAAGT 722 > gi|576583523|ref|NM_001289746.1| Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 4, mRNA Length=1407 Score = 44.1 bits (22), Expect = 2e-04 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 1 AGTCCTTCCACGATACCAAAGT 22 |||||||||||||||||||||| Sbjct 695 AGTCCTTCCACGATACCAAAGT 674 > gi|576583510|ref|NM_002046.5| Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 1, mRNA Length=1421 Score = 44.1 bits (22), Expect = 2e-04 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 1 AGTCCTTCCACGATACCAAAGT 22 |||||||||||||||||||||| Sbjct 709 AGTCCTTCCACGATACCAAAGT 688 > gi|576583518|ref|NM_001289745.1| Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 3, mRNA Length=1513 Score = 44.1 bits (22), Expect = 2e-04 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 1 AGTCCTTCCACGATACCAAAGT 22 |||||||||||||||||||||| Sbjct 801 AGTCCTTCCACGATACCAAAGT 780 > gi|950426250|ref|NM_000863.2| Homo sapiens 5-hydroxytryptamine receptor 1B (HTR1B), mRNA Length=3175 Score = 30.2 bits (15), Expect = 2.8 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 TCCACGATACCAAAG 21 ||||||||||||||| Sbjct 2135 TCCACGATACCAAAG 2121 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 3505770510 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2