BLASTN 2.4.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: rna.fa 176,426 sequences; 587,117,901 total letters Query= ACGAAACCAAGGTGGCTATG (evalue = 10) Length=20 Score E Sequences producing significant alignments: (Bits) Value gi|1034579321|ref|XM_017019251.1| PREDICTED: Homo sapiens heter... 40.1 0.002 gi|530400150|ref|XR_245923.1| PREDICTED: Homo sapiens heterogen... 40.1 0.002 gi|530400151|ref|XM_005268826.1| PREDICTED: Homo sapiens hetero... 40.1 0.002 gi|994318938|ref|NM_002136.3| Homo sapiens heterogeneous nuclea... 40.1 0.002 gi|994318937|ref|NM_031157.3| Homo sapiens heterogeneous nuclea... 40.1 0.002 gi|994321657|ref|NR_135167.1| Homo sapiens heterogeneous nuclea... 40.1 0.002 gi|732170465|ref|NM_021156.3| Homo sapiens thioredoxin related ... 34.2 0.12 gi|58761497|ref|NM_001011725.1| Homo sapiens heterogeneous nucl... 34.2 0.12 gi|58761495|ref|NM_001011724.1| Homo sapiens heterogeneous nucl... 34.2 0.12 gi|119943148|ref|NR_003277.1| Homo sapiens heterogeneous nuclea... 34.2 0.12 gi|296080701|ref|NM_004134.6| Homo sapiens heat shock protein f... 32.2 0.47 gi|1034691846|ref|XR_942588.2| PREDICTED: Homo sapiens uncharac... 30.2 1.9 gi|1034584323|ref|XM_006719946.3| PREDICTED: Homo sapiens G pro... 30.2 1.9 gi|1034637909|ref|XR_924718.2| PREDICTED: Homo sapiens uncharac... 30.2 1.9 gi|538260581|ref|NM_001282380.1| Homo sapiens actin-related pro... 28.2 7.3 gi|538260580|ref|NM_182616.3| Homo sapiens actin-related protei... 28.2 7.3 gi|356461014|ref|NM_015465.4| Homo sapiens gem nuclear organell... 28.2 7.3 gi|356461015|ref|NM_001252156.1| Homo sapiens gem nuclear organ... 28.2 7.3 gi|325651835|ref|NM_003601.3| Homo sapiens SWI/SNF related, mat... 28.2 7.3 gi|1034636496|ref|XM_017007509.1| PREDICTED: Homo sapiens splA/... 28.2 7.3 gi|312147328|ref|NM_001198952.1| Homo sapiens ring finger prote... 28.2 7.3 gi|1034699111|ref|XR_959034.2| PREDICTED: Homo sapiens uncharac... 28.2 7.3 gi|1034689595|ref|XR_926239.2| PREDICTED: Homo sapiens uncharac... 28.2 7.3 gi|767959569|ref|XR_930457.1| PREDICTED: Homo sapiens uncharact... 28.2 7.3 gi|585420406|ref|NM_001289987.1| Homo sapiens filamin A interac... 28.2 7.3 gi|585420408|ref|NM_015687.3| Homo sapiens filamin A interactin... 28.2 7.3 gi|664805972|ref|NM_001300866.1| Homo sapiens filamin A interac... 28.2 7.3 gi|1034649875|ref|XM_005248713.3| PREDICTED: Homo sapiens filam... 28.2 7.3 gi|1034649876|ref|XM_005248715.4| PREDICTED: Homo sapiens filam... 28.2 7.3 gi|1034618218|ref|XR_940320.2| PREDICTED: Homo sapiens uncharac... 28.2 7.3 > gi|1034579321|ref|XM_017019251.1| PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant X3, mRNA Length=1702 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ACGAAACCAAGGTGGCTATG 20 |||||||||||||||||||| Sbjct 934 ACGAAACCAAGGTGGCTATG 953 > gi|530400150|ref|XR_245923.1| PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant X1, misc_RNA Length=1441 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ACGAAACCAAGGTGGCTATG 20 |||||||||||||||||||| Sbjct 1165 ACGAAACCAAGGTGGCTATG 1184 > gi|530400151|ref|XM_005268826.1| PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant X2, mRNA Length=1661 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ACGAAACCAAGGTGGCTATG 20 |||||||||||||||||||| Sbjct 1165 ACGAAACCAAGGTGGCTATG 1184 > gi|994318938|ref|NM_002136.3| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 1, mRNA Length=1799 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ACGAAACCAAGGTGGCTATG 20 |||||||||||||||||||| Sbjct 1015 ACGAAACCAAGGTGGCTATG 1034 > gi|994318937|ref|NM_031157.3| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2, mRNA Length=1955 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ACGAAACCAAGGTGGCTATG 20 |||||||||||||||||||| Sbjct 1171 ACGAAACCAAGGTGGCTATG 1190 > gi|994321657|ref|NR_135167.1| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 3, non-coding RNA Length=1324 Score = 40.1 bits (20), Expect = 0.002 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 ACGAAACCAAGGTGGCTATG 20 |||||||||||||||||||| Sbjct 1015 ACGAAACCAAGGTGGCTATG 1034 > gi|732170465|ref|NM_021156.3| Homo sapiens thioredoxin related transmembrane protein 4 (TMX4), mRNA Length=6164 Score = 34.2 bits (17), Expect = 0.12 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 AAACCAAGGTGGCTATG 20 ||||||||||||||||| Sbjct 811 AAACCAAGGTGGCTATG 795 > gi|58761497|ref|NM_001011725.1| Homo sapiens heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 2, mRNA Length=2224 Score = 34.2 bits (17), Expect = 0.12 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 4 AAACCAAGGTGGCTATG 20 ||||||||||||||||| Sbjct 1832 AAACCAAGGTGGCTATG 1848 > gi|58761495|ref|NM_001011724.1| Homo sapiens heterogeneous nuclear ribonucleoprotein A1-like 2 (HNRNPA1L2), transcript variant 1, mRNA Length=2365 Score = 34.2 bits (17), Expect = 0.12 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 4 AAACCAAGGTGGCTATG 20 ||||||||||||||||| Sbjct 1973 AAACCAAGGTGGCTATG 1989 > gi|119943148|ref|NR_003277.1| Homo sapiens heterogeneous nuclear ribonucleoprotein A1 pseudogene 33 (HNRNPA1P33), non-coding RNA Length=542 Score = 34.2 bits (17), Expect = 0.12 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 3 GAAACCAAGGTGGCTAT 19 ||||||||||||||||| Sbjct 441 GAAACCAAGGTGGCTAT 457 > gi|296080701|ref|NM_004134.6| Homo sapiens heat shock protein family A (Hsp70) member 9 (HSPA9), mRNA Length=3506 Score = 32.2 bits (16), Expect = 0.47 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 4 AAACCAAGGTGGCTAT 19 |||||||||||||||| Sbjct 3359 AAACCAAGGTGGCTAT 3374 > gi|1034691846|ref|XR_942588.2| PREDICTED: Homo sapiens uncharacterized LOC105374217 (LOC105374217), ncRNA Length=4139 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GAAACCAAGGTGGCT 17 ||||||||||||||| Sbjct 3459 GAAACCAAGGTGGCT 3473 > gi|1034584323|ref|XM_006719946.3| PREDICTED: Homo sapiens G protein-coupled receptor 18 (GPR18), transcript variant X1, mRNA Length=2471 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 6 ACCAAGGTGGCTATG 20 ||||||||||||||| Sbjct 360 ACCAAGGTGGCTATG 374 > gi|1034637909|ref|XR_924718.2| PREDICTED: Homo sapiens uncharacterized LOC105374217 (LOC105374217), ncRNA Length=4139 Score = 30.2 bits (15), Expect = 1.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 GAAACCAAGGTGGCT 17 ||||||||||||||| Sbjct 3459 GAAACCAAGGTGGCT 3473 > gi|538260581|ref|NM_001282380.1| Homo sapiens actin-related protein 2/3 complex inhibitor (ARPIN), transcript variant 2, mRNA Length=6503 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 CCAAGGTGGCTATG 20 |||||||||||||| Sbjct 1358 CCAAGGTGGCTATG 1345 > gi|538260580|ref|NM_182616.3| Homo sapiens actin-related protein 2/3 complex inhibitor (ARPIN), transcript variant 1, mRNA Length=6114 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 CCAAGGTGGCTATG 20 |||||||||||||| Sbjct 969 CCAAGGTGGCTATG 956 > gi|356461014|ref|NM_015465.4| Homo sapiens gem nuclear organelle associated protein 5 (GEMIN5), transcript variant 1, mRNA Length=5404 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 CCAAGGTGGCTATG 20 |||||||||||||| Sbjct 1191 CCAAGGTGGCTATG 1178 > gi|356461015|ref|NM_001252156.1| Homo sapiens gem nuclear organelle associated protein 5 (GEMIN5), transcript variant 2, mRNA Length=5401 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 CCAAGGTGGCTATG 20 |||||||||||||| Sbjct 1188 CCAAGGTGGCTATG 1175 > gi|325651835|ref|NM_003601.3| Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (SMARCA5), mRNA Length=7926 Score = 28.2 bits (14), Expect = 7.3 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 1 ACGAAACCAAGGTGGCTA 18 |||| ||||||||||||| Sbjct 5612 ACGATACCAAGGTGGCTA 5595 > gi|1034636496|ref|XM_017007509.1| PREDICTED: Homo sapiens splA/ryanodine receptor domain and SOCS box containing 4 (SPSB4), transcript variant X1, mRNA Length=15118 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 GAAACCAAGGTGGC 16 |||||||||||||| Sbjct 4943 GAAACCAAGGTGGC 4930 > gi|312147328|ref|NM_001198952.1| Homo sapiens ring finger protein 103 (RNF103), transcript variant 3, mRNA Length=2970 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 4 AAACCAAGGTGGCT 17 |||||||||||||| Sbjct 1551 AAACCAAGGTGGCT 1538 > gi|1034699111|ref|XR_959034.2| PREDICTED: Homo sapiens uncharacterized LOC105376328 (LOC105376328), transcript variant X2, ncRNA Length=2081 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 GAAACCAAGGTGGC 16 |||||||||||||| Sbjct 1028 GAAACCAAGGTGGC 1041 > gi|1034689595|ref|XR_926239.2| PREDICTED: Homo sapiens uncharacterized LOC105374845 (LOC105374845), transcript variant X2, ncRNA Length=1881 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 AAACCAAGGTGGCT 17 |||||||||||||| Sbjct 935 AAACCAAGGTGGCT 948 > gi|767959569|ref|XR_930457.1| PREDICTED: Homo sapiens uncharacterized LOC105376328 (LOC105376328), transcript variant X1, ncRNA Length=1532 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 GAAACCAAGGTGGC 16 |||||||||||||| Sbjct 1028 GAAACCAAGGTGGC 1041 > gi|585420406|ref|NM_001289987.1| Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant 1, mRNA Length=4856 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CGAAACCAAGGTGG 15 |||||||||||||| Sbjct 598 CGAAACCAAGGTGG 611 > gi|585420408|ref|NM_015687.3| Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant 2, mRNA Length=4690 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CGAAACCAAGGTGG 15 |||||||||||||| Sbjct 432 CGAAACCAAGGTGG 445 > gi|664805972|ref|NM_001300866.1| Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant 4, mRNA Length=3999 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CGAAACCAAGGTGG 15 |||||||||||||| Sbjct 432 CGAAACCAAGGTGG 445 > gi|1034649875|ref|XM_005248713.3| PREDICTED: Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant X1, mRNA Length=5108 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CGAAACCAAGGTGG 15 |||||||||||||| Sbjct 403 CGAAACCAAGGTGG 416 > gi|1034649876|ref|XM_005248715.4| PREDICTED: Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant X2, mRNA Length=4884 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CGAAACCAAGGTGG 15 |||||||||||||| Sbjct 403 CGAAACCAAGGTGG 416 > gi|1034618218|ref|XR_940320.2| PREDICTED: Homo sapiens uncharacterized LOC105374845 (LOC105374845), transcript variant X1, ncRNA Length=2025 Score = 28.2 bits (14), Expect = 7.3 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 AAACCAAGGTGGCT 17 |||||||||||||| Sbjct 1079 AAACCAAGGTGGCT 1092 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Effective search space used: 2337180340 Database: rna.fa Posted date: Jan 6, 2017 3:58 PM Number of letters in database: 587,117,901 Number of sequences in database: 176,426 Matrix: blastn matrix 1 -3 Gap Penalties: Existence: 5, Extension: 2